Nucleotide Count

Clojure Track: Nucleotide Count

Given a string representing a DNA sequence, count how many of each nucleotide is present.

If the string contains characters other than A, C, G, or T then an error should be throw.

Represent a DNA sequence as an ordered collection of nucleotides, e.g. a string of characters such as "ATTACG".

"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
"INVALID" -> error

DNA Nucleotide names

A is Adenine, C is Cytosine, G is Guanine and T is Thymine

Code for this solution on GitHub

practicalli/exercism-clojure-guides contains the design journal and solution to this exercise and many others.

Create the project

Download the Nucleotide Count exercise using the exercism CLI tool

exercism download --exercise=nucleotide-count --track=clojure

Use the REPL workflow to explore solutions locally

Open the project in a Clojure aware editor and start a REPL, using a rich comment form to experiment with code to solve the challenge.

Starting point

Unit test code calls functions from the src tree which must exist with the correct argument signature for the unit test code to compile successfully.

Reviewing each assertion in the unit test code identifies the function definitions required.

Exercism Unit Tests

(ns nucleotide-count-test
  (:require [clojure.test :refer [deftest is]]
            nucleotide-count))

(deftest empty-dna-strand-has-no-adenosine
  (is (= 0 (nucleotide-count/count-of-nucleotide-in-strand \A, ""))))

(deftest empty-dna-strand-has-no-nucleotides
  (is (= {\A 0, \T 0, \C 0, \G 0}
         (nucleotide-count/nucleotide-counts ""))))

(deftest repetitive-cytidine-gets-counted
  (is (= 5 (nucleotide-count/count-of-nucleotide-in-strand \C "CCCCC"))))

(deftest repetitive-sequence-has-only-guanosine
  (is (= {\A 0, \T 0, \C 0, \G 8}
         (nucleotide-count/nucleotide-counts "GGGGGGGG"))))

(deftest counts-only-thymidine
  (is (= 1 (nucleotide-count/count-of-nucleotide-in-strand \T "GGGGGTAACCCGG"))))

(deftest validates-nucleotides
  (is (thrown? Throwable (nucleotide-count/count-of-nucleotide-in-strand \X "GACT"))))

(deftest counts-all-nucleotides
  (let [s "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"]
    (is (= {\A 20, \T 21, \G 17, \C 12}
           (nucleotide-count/nucleotide-counts s)))))

Function definitions required to compile unit test code

src/nucleotide_count.clj

(ns nucleotide-count)

(defn count-of-nucleotide-in-strand
  "Count how many of a given nucleotide is in a strand"
  [nucleotide strand])

(defn nucleotide-counts
  "Count all nucleotide in a strand"
  [strand])

Making the tests pass

Select one assertion from the unit tests and write code to make the test pass.

Experiment with solutions in the comment form and add the chosen approach to the respective function definition.

Counting nucleotides

Use test data from the unit test code, e.g. "GGGGGTAACCCGG"

How often does a nucleotide appear

Example

  (map
    #(if (= % \A) 1 0)
    "GGGGGTAACCCGG")

Add the result to get the total count

Example

  (count
   (map
     #(if (= % \A) 1 0)
     "GGGGGTAACCCGG"))

Is there a more elegant way?

When only the matching nucleotide is in the strand, then all the elements of the strand can be counted.

filter the DNA strand with a predicate function (returns true/false) that returns only the matching nucleotide.

Example

  (filter #(= % \A) valid-nucleotides))

;; Count the elements in the returned sequence for the total

Example

  (count
   (filter #(= % \A) valid-nucleotides))

Add this code into the starting function

Run unit tests

Run the unit tests to see if they pass. x should pass, x should fail.

Nucleotide occurances

Count the occurances

"GGGGGTAACCCGG"

   (count
     (filter (fn [nucleotide] (= nucleotide \A))
             "GGGGGTAACCCGG"))

Define the data

  (def valid-nucleotides
    "Characters representing valid nucleotides"
    [\A \C \G \T])

Exception handling required

(throw (Throwable.)) if nucleotide is \X

Or use a predicate with some (some element? in the sequence)

  (some #(= \G %) valid-nucleotides)

  (some #{\G} valid-nucleotides)

  (defn count-of-nucleotide-in-strand
    [nucleotide strand]
    (if (some #(= nucleotide %) valid-nucleotides)
      (count
       (filter #(= nucleotide %)
               strand))
      (throw (Throwable.))))

  (count-of-nucleotide-in-strand \T "GGGGGTAACCCGG")

Design the second function

How often does a nucleotide appear

  (map
    #(if (= % \A) 1 0)
    valid-nucleotides)

Add the result to get the total count

Is there a more elegant way?

  (filter #(= % \A) valid-nucleotides)

Count the elements in the returned sequence for the total

Design the second function

How often does a nucleotide appear

NOTE: zero must be returned when there are no appearences

Return value always in the form

  {\A 20, \T 21, \G 17, \C 12}

Hammock time...

• How often does something appear,
• how frequenct is it?
• Is there a clojure standard library for that (approx 700 functions), review https://clojure-docs.org/

  (frequencies "GGGGGAACCCGG")

If there are missing nucleotides then there is no answer

What if there is a starting point

  {\A 0 \C 0 \G 0 \T 0}

;; Then merge the result of frequencies

  (merge {\A 0 \C 0 \G 0 \T 0}
         (frequencies "GGGGGAACCCGG"))

Update the function definition and run tests

Solutions

There are many ways to solve a challenge and there is value trying different approaches to help learn more about the Clojure language.

The following solution includes filter and frequencies functions which are commonly used functions from the Clojure standard library.

Example Solution

src/nucleotide_count.clj

(ns nucleotide-count)

(def valid-nucleotides
    "Characters representing valid nucleotides"
    [\A \C \G \T])

(defn count-of-nucleotide-in-strand
  [nucleotide strand]
  (if (some #(= nucleotide %) valid-nucleotides)
    (count
     (filter #(= nucleotide %)
             strand))
    (throw (Throwable.))))

(defn nucleotide-counts
  "Count all nucleotide in a strand"
  [strand]
  (merge {\A 0 \C 0 \G 0 \T 0}
         (frequencies "GGGGGAACCCGG")))